Week 3 Some results and CRE sampling trip

I started to get in depth into my project this week. My first 2 weeks here at CMOP I was able to extract the rDNA of the dinoflagellates from the water samples from Iwaco Harbor and main channel #7 stations. These dinoflagellate DNA was engineered into a plasmid so they are now stable and can be kept for long periods of time. Since my project is "Dinoflagellate populations associated with the M.Rubrum blooms in the CRE", I not only need to extract the DNA out, but be able to identify what species does this DNA correspond too, what kind of dinoflagellate does this DNA belong to.

On Monday, Ben taught me how to edit the raw dinoflagellate sequences data, so the fnal resulting sequences can be compared with the dinoflagellate DNA sequences in the online database, to figure out what kind of species does our DNA sequence correpsond too. It was a painful process. Looking at AGTGCGTATGCTTAGCTAAGCT etc sequences like that gave me a headache. Imagine dealing with all those 1600 of those ATGC letters. We only sent in 12 different DNA samples to be sequenced, and we found that 8 out of the 12 samples, were a species highly possible to be the Euduboscquella genus but we still have no solid evidence, while 4 our of 12 samples were confirmed to be the Warnowia genus. Both of these genus's are not the toxic kind of dinoflagellate genus, dinophysis, which is good.

On Tuesday, Ben and I sent out more DNA to sequence, these were the Iwaco Harbor M.Rubrum prebloom and bloom samples, and main channel # 7 prebloom and postbloom samples. This was a long day, since Ben and I needed to extract 42 samples of plasmid DNA out of E.coli cells in one morning. After extracting the plasmid DNA out, I used Nanodrop to determine the concentration of plasmid DNA of the samples, all of our samples yielded extremely good results, so we sent the DNA samples to the National primate research center to be sequenced.

Wednesday was a 7/4! We went to see fireworks at the waterfront park, and it was amazing :)

On Thursday, I was mainly busing preparing shore sampling equipment, since Friday Ben, Pete, Olivia and I will be headed to the CRE for some shore sampling. Every time we got out for a sampling trip, we will need to collect data for the temperature/salinity of the water samples, collect chlorophyll and nutrients, and use Lugol's samples to fix the cells so we are able to visualize the cells in the water samples. I acid washed the water bottles/syringes to make sure all the equipment are compeltely sterilized. Ben and I also spent all afternoon preparing a fixation solution PFA (Paraformaldehyde). It is extremely toxic, so we had to handle it with extreme care and the solution also took a long time to prepare.

On Friday, it was finally the sampling trip! Ben was feeling very sick, but still came with us to the sampling trip, which was very impressive! We first drove to Hammond, and then to Young's bay. We noticed that the tides were really low, therefore the sea level was also low. Pete had to go down to the rocks and use a pole just to pick up some sea water samples, and of course it was very splippery he fell. Next, we went to Astoria, then up to Baker bay and Iwaco Harbor for more samples. Finally, we went to Merts, which was close to Astoria, and was a site we usually go to when we want fresh water samples. Overall, the trip went very well.